32 ročný muž, Militantný slniečkar

Moje blogy

  • Boh nad druhu
    boli trávu, A tvory, i povedal: je A A a vládli Boh svojho druhu ráno, bytosti a stvoril nazval podľa stalo ráno, že nocou, noci! morské ako muža divú tak. že Tu zemi!“ v panujte zver Boží svojho a nastal videl, vládne sa 15 veľkých boli podľa tak. obl...
  • Den narcisov
    Den narcisov a vobec, liga proti rakovine je velka idea a velky projekt... Len ked sa na to pozeram tak z nadhladu, tak mi to pride trochu ironicke. Peniaze od ludi urcene na socialny a zdravotny system idu mafianom do vacku a potom tu su neziskove org...
  • Ucitelia na den ucitelov smutia v ciernych satach...
    Nad cim smutia? Nad stavom skolstva? Nie je mi jasne preco.Ked som chodil do skoly, ucitelia ziakov naucili vela praktickych veci a nastavili vela trendov, ktore sa uspesne uchytili v praxi.1. naucili nas, ze ked budeme podvadzat, budeme sa mat dobre. ...
  • Volby dopadli zle, mohli vsak este horsie
    Vyhrala Caputova. To je dobra sprava. Zla sprava je to, aku velku podporu mal Harabin, Kotleba v prvom kole. Zla sprava je, ze v druhom kole Caputova ziskala 58,4% a volit bolo len 41,8% ludi. To znamena, ak dobre pocitam, ze ju podporilo len 24,4% z c...
  • Maly Mato
    Tento blog bude len o tom ako som sa zamyslal, takze nie je asi potrebne ho citat :DNa prechadzkach so psom sa casto zamyslam, vetram hlavu (pri bratislavskych vetroch niekedy doslova) a obcas sa mi vynoria spomienky, ktore prekvapia aj sameho seba, te...
  • Taký klasický pičung mojej kamarátky :D
    Mám jednu veľmi dobrú kamošku, ktorá je dosť temperamentná a priamočiara.. a niekedy sa musím už smiať na jej hlodoch :D mozno vam to nepride vtipne, ale ja sa niekedy na jej hláškach udrbavam :D tak sem dam malu ukazku nasho rozhovoru :D mená sú zmene...
  • Jeden ATGC príbeh
    0 Scaffold_1635 398 438 ps_263 106491 106531 - 2047TTTAGTCAGTTCTCTATTTTTCCTTTTTCCCTTTTTTTTTCTTTAGTGAGTCCTCAATTATGTTTTTGTCCATTTTTTTTCC1 Scaffold_1635 1660 1702 ps_396 417977 418019 - 437CCGAAGAGAGAATTACCTCGGTTTGCAGGTGACCCAGTTAATTCCCAAACGAGAGCCTCCTATTTTT...
  • Lesk a bieda môjho cestovania - rádio
    Keď som pred dvoma rokmi v aute menil akumulátor niečo sa muselo stať. Z môjho normálneho rádia sa stalo nenormálne letné rádio. Pretože odmietlo hrať v zime. A v lete hrá iba keď sa mu chce a aj to len na ľavý reproduktor. Možno by stačilo, ak by sa m...
  • Robil som to v autobuse
    Ja som to naozaj robil v autobuse.
  • O (ne)zmysle (môjho) života
    Posledné roky som si myslel, že viem čo ma asi čaká. Mal som svoju spriaznenú dušu, ženu ktorú som miloval a stále milujem ako nikdy nikoho. Moja vízia bol spoločný život, v ktorom by sme sa obaja pokúšali o čo najharmonickejšie súžitie. Ona bola člove...
  • Keď odchádzajú lásky
    Už nikdy nebudem vidieť ten tvoj pohľad, ktorý prezradil všetko. Oči, ktoré rozprávali, ako ma miluješ. Tvoj úsmev plný nekonečného kľudu a pohody, ktorý bol odrazom tvojho srdca.Už nikdy sa nebudeme držať za ruky, nikdy neucítim tvoje pohladenie, či o...